Incredible researchers from all around the world worked tirelessly over the past year to end this generation’s most challenging health crisis. None of these scientists had anything to do with that. This group probably couldn’t have done it even if they put all of their work together. Take a look at some of the worst vaccine researchers in the game right now.
1. Dr. Anthony Stall
No surprise here, you should have seen his shoddy work during the swine flu outbreak.
2. Dr. Jessica Epps
It’s almost as if she was trying to mess up because she hates old people. Better luck next devastating pandemic, Dr. Epps.
3. Dr. Gary W. Horman
Do not let their lab coat and gentle smile deceive you, Dr. Horman was an awful scientist this year and should be reminded of that every day.
4. Dr. Matthew Gernstopper
This doctor actually started out in the lead but decided to quit halfway through because he began to earn enough money on his YouTube channel where he reviews the accuracy of doctor scenes in movies.
5. Dr. Lena Chawla
She thought the genome ended in GCCAGGTTACTCAGGATCGAGACCGT instead of GCCAGGTTACTCAGGATCGAGACGGT. Can you believe that?
6. Dr. Brendan Apsterprowski III
Dr. Apsterprowski III comes from a long line of just awful medical researchers. His father completely missed the measles vaccine and his father’s father might as well have been a damn chiropractor during smallpox.